Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3383191
End position: 3383217
Length: 27

DNA sequence
>NC_008699, from 3383191 to 3383217 (27 bp); Nocardioides sp. JS614 CCGGCAGCCCCGGCAGCCCCGGCCGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3382733-3384781	Sequence	Noca_3184 - PTS system fructose subfamily transporter subunit IIC