Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3072612
End position: 3072638
Length: 27

DNA sequence
>NC_008699, from 3072612 to 3072638 (27 bp); Nocardioides sp. JS614 CGTCCTGGGCGTCCCGGGCGTCCCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3071650-3073611	Sequence	Noca_2889 - protoporphyrin IX magnesium-chelatase (Protein is coded in complementary strand; from 3073611 to 3071650)