Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3045283
End position: 3045309
Length: 27

DNA sequence
>NC_008699, from 3045283 to 3045309 (27 bp); Nocardioides sp. JS614 GCCAGCACCGCCAGGACCGCGAGCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3045211-3048294	Sequence	Noca_2867 - hypothetical protein (Protein is coded in complementary strand; from 3048294 to 3045211)