Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2987377
End position: 2987403
Length: 27

DNA sequence
>NC_008699, from 2987377 to 2987403 (27 bp); Nocardioides sp. JS614 CGGCCGGCGCGGTCGGCGCGGTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2986850-2987536	Sequence	Noca_2817 - hypothetical protein (Protein is coded in complementary strand; from 2987536 to 2986850)