Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 275705
End position: 275731
Length: 27

DNA sequence
>NC_008699, from 275705 to 275731 (27 bp); Nocardioides sp. JS614 CACTCGGCGCGCTCGGCGCCCTCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 275612-276055	Sequence	Noca_0257 - hypothetical protein (Protein is coded in complementary strand; from 276055 to 275612)