Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2198027
End position: 2198053
Length: 27

DNA sequence
>NC_008699, from 2198027 to 2198053 (27 bp); Nocardioides sp. JS614 CGACCGCACCGACCACACCGACCACAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2198024-2198569	Sequence	Noca_2053 - glyoxalase/bleomycin resistance protein/dioxygenase