Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1351137
End position: 1351163
Length: 27

DNA sequence
>NC_008699, from 1351137 to 1351163 (27 bp); Nocardioides sp. JS614 AGCAGGAACAGCAGGATCAGCAGGACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1350681-1351178	Sequence	Noca_1277 - hypothetical protein (Protein is coded in complementary strand; from 1351178 to 1350681)