Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 764147
End position: 764170
Length: 24

DNA sequence
>NC_008699, from 764147 to 764170 (24 bp); Nocardioides sp. JS614 CCGGCTCGGGCTGCGGCTCCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 763795-764775	Sequence	Noca_0719 - hypothetical protein (Protein is coded in complementary strand; from 764775 to 763795)