Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4833944
End position: 4833967
Length: 24

DNA sequence
>NC_008699, from 4833944 to 4833967 (24 bp); Nocardioides sp. JS614 CGGCGTCGGAGTCGGCGGCGGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4833517-4834218	Sequence	Noca_4566 - abortive infection protein (Protein is coded in complementary strand; from 4834218 to 4833517)