Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4729437
End position: 4729460
Length: 24

DNA sequence
>NC_008699, from 4729437 to 4729460 (24 bp); Nocardioides sp. JS614 GGCGGCCGCGGCGGCGTCGGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4728175-4729635	Sequence	Noca_4473 - succinate semialdehyde dehydrogenase (Protein is coded in complementary strand; from 4729635 to 4728175)