Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4718777
End position: 4718800
Length: 24

DNA sequence
>NC_008699, from 4718777 to 4718800 (24 bp); Nocardioides sp. JS614 CGCGAGCGCGATCGGGAGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4718706-4719881	Sequence	Noca_4465 - NADH-ubiquinone oxidoreductase, chain 49kDa (Protein is coded in complementary strand; from 4719881 to 4718706)