Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4231835
End position: 4231858
Length: 24

DNA sequence
>NC_008699, from 4231835 to 4231858 (24 bp); Nocardioides sp. JS614 GCGCGAGCTCGAGCGCGAGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4231597-4232319	Sequence	Noca_4009 - short-chain dehydrogenase/reductase SDR (Protein is coded in complementary strand; from 4232319 to 4231597)