Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4205794
End position: 4205817
Length: 24

DNA sequence
>NC_008699, from 4205794 to 4205817 (24 bp); Nocardioides sp. JS614 CCGCCCCCGCCACCGTCCCCGCCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4204968-4205864	Sequence	Noca_3985 - GDSL family lipase (Protein is coded in complementary strand; from 4205864 to 4204968)