Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 4199161
End position: 4199184
Length: 24

DNA sequence
>NC_008699, from 4199161 to 4199184 (24 bp); Nocardioides sp. JS614 CCGTGCCCGTGGTCGTGCCCGTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 4198861-4199700	Sequence	Noca_3980 - hemerythrin HHE cation binding domain-containing protein (Protein is coded in complementary strand; from 4199700 to 4198861)