Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 398763
End position: 398786
Length: 24

DNA sequence
>NC_008699, from 398763 to 398786 (24 bp); Nocardioides sp. JS614 CGTCGGCTTCGGCCTCGGCGTCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 396899-399277	Sequence	Noca_0372 hppA membrane-bound proton-translocating pyrophosphatase