Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3897023
End position: 3897046
Length: 24

DNA sequence
>NC_008699, from 3897023 to 3897046 (24 bp); Nocardioides sp. JS614 AGCGCGATCGCGTGCGCGAGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3896816-3897853	Sequence	Noca_3674 - uroporphyrinogen decarboxylase (Protein is coded in complementary strand; from 3897853 to 3896816)