Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3859967
End position: 3859990
Length: 24

DNA sequence
>NC_008699, from 3859967 to 3859990 (24 bp); Nocardioides sp. JS614 TGCTGCTGCGGCTGCTGGTGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3858439-3860193	Sequence	Noca_3637 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 3860193 to 3858439)