Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3727720
End position: 3727743
Length: 24

DNA sequence
>NC_008699, from 3727720 to 3727743 (24 bp); Nocardioides sp. JS614 GCGGCGACGGCGGCGTCGGAGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3727351-3728505	Sequence	Noca_3516 - SpoIID/LytB domain-containing protein (Protein is coded in complementary strand; from 3728505 to 3727351)