Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3708878
End position: 3708901
Length: 24

DNA sequence
>NC_008699, from 3708878 to 3708901 (24 bp); Nocardioides sp. JS614 CGGCTGCTGCTGCGGCGGCTGCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3708480-3709550	Sequence	Noca_3500 - response regulator receiver (Protein is coded in complementary strand; from 3709550 to 3708480)