Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3684347
End position: 3684370
Length: 24

DNA sequence
>NC_008699, from 3684347 to 3684370 (24 bp); Nocardioides sp. JS614 CGTGCCCGTGCCCGTGCCCGTGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3684280-3684960	Sequence	Noca_3474 - hypothetical protein (Protein is coded in complementary strand; from 3684960 to 3684280)