Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3684346
End position: 3684369
Length: 24

DNA sequence
>NC_008699, from 3684346 to 3684369 (24 bp); Nocardioides sp. JS614 TCGTGCCCGTGCCCGTGCCCGTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3684280-3684960	Sequence	Noca_3474 - hypothetical protein (Protein is coded in complementary strand; from 3684960 to 3684280)