Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3657476
End position: 3657499
Length: 24

DNA sequence
>NC_008699, from 3657476 to 3657499 (24 bp); Nocardioides sp. JS614 GAGCTCGAGCACGATCTCCAGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3656400-3657950	Sequence	Noca_3449 obgE GTPase ObgE (Protein is coded in complementary strand; from 3657950 to 3656400)