Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3653394
End position: 3653417
Length: 24

DNA sequence
>NC_008699, from 3653394 to 3653417 (24 bp); Nocardioides sp. JS614 TCGGCGACGGCGTCGACGTCGGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3653349-3654548	Sequence	Noca_3446 - class V aminotransferase (Protein is coded in complementary strand; from 3654548 to 3653349)