Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3627525
End position: 3627548
Length: 24

DNA sequence
>NC_008699, from 3627525 to 3627548 (24 bp); Nocardioides sp. JS614 ACCAGCGCCAGCACCAGGACCACC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3626712-3627761	Sequence	Noca_3422 - hypothetical protein (Protein is coded in complementary strand; from 3627761 to 3626712)