Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3551020
End position: 3551043
Length: 24

DNA sequence
>NC_008699, from 3551020 to 3551043 (24 bp); Nocardioides sp. JS614 AGCACGAGCCCGAGCCCGAGCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3550987-3551544	Sequence	Noca_3348 - TetR family transcriptional regulator (Protein is coded in complementary strand; from 3551544 to 3550987)