Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3540740
End position: 3540763
Length: 24

DNA sequence
>NC_008699, from 3540740 to 3540763 (24 bp); Nocardioides sp. JS614 GGCGAGCGCGAGGCCGAGGGCGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3539943-3540935	Sequence	Noca_3335 - abortive infection protein (Protein is coded in complementary strand; from 3540935 to 3539943)