Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 348897
End position: 348920
Length: 24

DNA sequence
>NC_008699, from 348897 to 348920 (24 bp); Nocardioides sp. JS614 GGCCACCGCCACCGCCACCGCCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 348827-351250	Sequence	Noca_0326 - glycosyl transferase family protein (Protein is coded in complementary strand; from 351250 to 348827)