Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 346739
End position: 346762
Length: 24

DNA sequence
>NC_008699, from 346739 to 346762 (24 bp); Nocardioides sp. JS614 CGGCTCCCGCTCGGGCTCGGGCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 346350-347027	Sequence	Noca_0323 - hypothetical protein (Protein is coded in complementary strand; from 347027 to 346350)