Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3442491
End position: 3442514
Length: 24

DNA sequence
>NC_008699, from 3442491 to 3442514 (24 bp); Nocardioides sp. JS614 CGCGACCACGACCGCCACGGCGAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3441787-3442713	Sequence	Noca_3239 - phosphatidate cytidylyltransferase (Protein is coded in complementary strand; from 3442713 to 3441787)