Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3341281
End position: 3341304
Length: 24

DNA sequence
>NC_008699, from 3341281 to 3341304 (24 bp); Nocardioides sp. JS614 GACGTCGATGTCGACGTGGACGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3340739-3341947	Sequence	Noca_3138 - ErfK/YbiS/YcfS/YnhG family protein (Protein is coded in complementary strand; from 3341947 to 3340739)