Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3207802
End position: 3207825
Length: 24

DNA sequence
>NC_008699, from 3207802 to 3207825 (24 bp); Nocardioides sp. JS614 TCGCGCTCGCGCTCGTGCTCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3207586-3208380	Sequence	Noca_3011 - polar amino acid ABC transporter, inner membrane subunit