Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 319407
End position: 319430
Length: 24

DNA sequence
>NC_008699, from 319407 to 319430 (24 bp); Nocardioides sp. JS614 CTGGTCCCGGTCCCGGTCGTGGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 319285-319470	Sequence	Noca_0301 - hypothetical protein (Protein is coded in complementary strand; from 319470 to 319285)