Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3186262
End position: 3186285
Length: 24

DNA sequence
>NC_008699, from 3186262 to 3186285 (24 bp); Nocardioides sp. JS614 GCGAACGCGACCGCCAACGGGAAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3185143-3186342	Sequence	Noca_2995 - UDP-glucose/GDP-mannose dehydrogenase (Protein is coded in complementary strand; from 3186342 to 3185143)