Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 3104867
End position: 3104890
Length: 24

DNA sequence
>NC_008699, from 3104867 to 3104890 (24 bp); Nocardioides sp. JS614 ACCGCGACCGCGACCGCGACCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3102500-3105286	Sequence	Noca_2922 - copper-translocating P-type ATPase (Protein is coded in complementary strand; from 3105286 to 3102500)