Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2666106
End position: 2666129
Length: 24

DNA sequence
>NC_008699, from 2666106 to 2666129 (24 bp); Nocardioides sp. JS614 ACGTCGTCGTCGACGGCGAGGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2665992-2666747	Sequence	Noca_2497 - ribosomal large subunit pseudouridine synthase B