Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2411841
End position: 2411864
Length: 24

DNA sequence
>NC_008699, from 2411841 to 2411864 (24 bp); Nocardioides sp. JS614 CGGCGTCGGCGGCGGTGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2410307-2411887	Sequence	Noca_2259 - nuclease (Protein is coded in complementary strand; from 2411887 to 2410307)