Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2321081
End position: 2321104
Length: 24

DNA sequence
>NC_008699, from 2321081 to 2321104 (24 bp); Nocardioides sp. JS614 CGATCCCGATCGGGATCCCGACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2320036-2321700	Sequence	Noca_2169 - EmrB/QacA family drug resistance transporter (Protein is coded in complementary strand; from 2321700 to 2320036)