Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2245104
End position: 2245127
Length: 24

DNA sequence
>NC_008699, from 2245104 to 2245127 (24 bp); Nocardioides sp. JS614 CGACGGCGACGCCCACGGCCACGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2243747-2246482	Sequence	Noca_2101 - multicopper oxidase, type 3 (Protein is coded in complementary strand; from 2246482 to 2243747)