Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2192938
End position: 2192961
Length: 24

DNA sequence
>NC_008699, from 2192938 to 2192961 (24 bp); Nocardioides sp. JS614 TCGCCGTCGACGACGCCGCCGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2192434-2195421	Sequence	Noca_2048 - bifunctional glutamine-synthetase adenylyltransferase/deadenyltransferase