Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2145684
End position: 2145707
Length: 24

DNA sequence
>NC_008699, from 2145684 to 2145707 (24 bp); Nocardioides sp. JS614 CGCGAGCGCGAGCGCCAGCGCGGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2145205-2145753	Sequence	Noca_2003 - hypothetical protein (Protein is coded in complementary strand; from 2145753 to 2145205)