Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2065066
End position: 2065089
Length: 24

DNA sequence
>NC_008699, from 2065066 to 2065089 (24 bp); Nocardioides sp. JS614 CGTGCTCGTGCGGGTGCTCGTCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2064963-2065976	Sequence	Noca_1935 - ABC-3 protein (Protein is coded in complementary strand; from 2065976 to 2064963)