Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 2049342
End position: 2049365
Length: 24

DNA sequence
>NC_008699, from 2049342 to 2049365 (24 bp); Nocardioides sp. JS614 TCGTCGTCGTAGTCGACGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2048814-2049614	Sequence	Noca_1922 - hypothetical protein (Protein is coded in complementary strand; from 2049614 to 2048814)