Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1907313
End position: 1907336
Length: 24

DNA sequence
>NC_008699, from 1907313 to 1907336 (24 bp); Nocardioides sp. JS614 GCGCCGGGGCCGGGGCCGGAGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1906238-1907578	Sequence	Noca_1794 - hypothetical protein (Protein is coded in complementary strand; from 1907578 to 1906238)