Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 18761
End position: 18784
Length: 24

DNA sequence
>NC_008699, from 18761 to 18784 (24 bp); Nocardioides sp. JS614 GCCGGCGCGGGCGCCGGGGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 18611-19255	Sequence	Noca_0016 - hypothetical protein (Protein is coded in complementary strand; from 19255 to 18611)