Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 183264
End position: 183287
Length: 24

DNA sequence
>NC_008699, from 183264 to 183287 (24 bp); Nocardioides sp. JS614 CGCGGCCTCGGCCGCGACCGGGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 182923-183609	Sequence	Noca_0169 - circadian phase modifier CpmA (Protein is coded in complementary strand; from 183609 to 182923)