Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1503058
End position: 1503081
Length: 24

DNA sequence
>NC_008699, from 1503058 to 1503081 (24 bp); Nocardioides sp. JS614 CGAGAACGCGAACGCGAACGGGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1502324-1503154	Sequence	Noca_1418 - binding-protein-dependent transport systems inner membrane component (Protein is coded in complementary strand; from 1503154 to 1502324)