Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1325485
End position: 1325508
Length: 24

DNA sequence
>NC_008699, from 1325485 to 1325508 (24 bp); Nocardioides sp. JS614 ACGAGGTCGAGGTCGAGGTCGAGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1325452-1325817	Sequence	Noca_1250 - biotin/lipoyl attachment domain-containing protein