Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 131731
End position: 131754
Length: 24

DNA sequence
>NC_008699, from 131731 to 131754 (24 bp); Nocardioides sp. JS614 GTCGGCCTCGGCGTCGGCGTCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 131399-132259	Sequence	Noca_0118 - hypothetical protein (Protein is coded in complementary strand; from 132259 to 131399)