Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1307783
End position: 1307806
Length: 24

DNA sequence
>NC_008699, from 1307783 to 1307806 (24 bp); Nocardioides sp. JS614 GGATCCGGAACCAGATCCGGATCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1307023-1307910	Sequence	Noca_1230 - hypothetical protein (Protein is coded in complementary strand; from 1307910 to 1307023)