Sequence retrieval

Genome: Nocardioides sp. JS614
Start position: 1279572
End position: 1279595
Length: 24

DNA sequence
>NC_008699, from 1279572 to 1279595 (24 bp); Nocardioides sp. JS614 GGCCCCGGCGCCGGCCGCGACCCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1279129-1279923	Sequence	Noca_1205 - enoyl-CoA hydratase (Protein is coded in complementary strand; from 1279923 to 1279129)